Beware the beast Man, for he is the Devil's pawn

[Tristam]

And what explains the natural processes?


First cause is *entirely* the point of the watch argument. There's absolutely nothing we can't explain scientifically about the watch, unless it's simply been there so long that we can no longer decipher who left it there.


I think the problem is you're looking at the watch as "humankind" or "earth" specifically, when the watch represents the entire universe, and whatever is or isn't beyond it.

Except Paley specifically meant the watch to be nature, humankind, and conceived with a purpose. He specifically *avoids* first cause (see the stone below). I think you're confusing the watch with the stone. Again, with first causes, the answer is that thus far what we know does not *require* a god. The only answer we can say with any certainty with respect to first causes is that we do not know, however that does not by itself invalidate natural causes, nor justify supernatural causes. Just because we do not know, does not mean you must ascribe the unknown to god, that is the god of the gaps. Rather, prove to me that something about first causes *necessitates* the existence of a god, and that that god itself requires no first cause.


Paley's original argument:

"In crossing a heath, suppose I pitched my foot against a stone, and were asked how the stone came to be there; I might possibly answer, that, for anything I knew to the contrary, it had lain there forever: nor would it perhaps be very easy to show the absurdity of this answer. But suppose I had found a watch upon the ground, and it should be inquired how the watch happened to be in that place; I should hardly think of the answer I had before given, that for anything I knew, the watch might have always been there. (...) There must have existed, at some time, and at some place or other, an artificer or artificers, who formed [the watch] for the purpose which we find it actually to answer; who comprehended its construction, and designed its use. (...) Every indication of contrivance, every manifestation of design, which existed in the watch, exists in the works of nature; with the difference, on the side of nature, of being greater or more, and that in a degree which exceeds all computation."

[Kerberoz]

If someone made the watch, where did the watchmaker come from? Who makes the watchmaker? Who makes the watchmaker-maker?

Obviously, the religious answer is "the watchmaker was always there". So in order to explain a complex system existing, you believe that an even more complex system has always existed to create it? Why not cut out the middleman and realize that the watch has always existed?

[Faris]

The information that counters "god" is readily available and there are many people out in the world challenging it on a daily basis. However, regardless of evidence, you will not convince a large percentage of believers, simply due to them taking everything they know on "faith" over fact.

A politician would commit political suicide if they announced this, so you wont see any world leaders doing it anytime soon. And scientist state this fact quite often, so what else would you like Firas? The entire world isnt going to see fact and suddenly change thousands of years of superstition, especially with a WIDE range of varying education and backgrounds.

Look at you for instance Firas. You were provided with no less than 5 direct counters to your religious text, and the best you can do is ignore it and say "well if there wasnt a god, someone would have told me!".

Really..

sorry, i was provided with theories...no facts, if science cannot provide facts, then its never going to disprove creationism.

the entire fucking world changed and changed and changed, and it can change away from this, if someone can really prove that there is no God, but noone can prove that...

they.are.just.fucking.theories

[zoobernut]

I like how you use that argument from that direction then try to explain how religion has provided facts. If you are going to play that game then Everything that religion tells us is equally a theory of how the world works. And all you have provided us are theories that you like to believe that describe how the world came into existence and how natural phenomenon work but in the end they are just theories the same as science. The only difference is rather than understanding they are theories you believe them in blind faith. That is the key difference between science and religion. Science is not believed on blind faith it has to prove itself, religion does not.

[Mizango]

LOOOOL

Science is just theories? HAHAHAHAHAHA

[Mizango]

Yeah I am still waiting on those supposed "facts" that prove beyond a shadow of a doubt that God exists..... so is all of humanity.

[kareface]

you're just trying too hard now. your reply makes no sense about the watch in the desert, sorry.

Just because you don't understand it doesn't make it false. I'll dumb it down for you. Simply put, a watch is designed to tell time, you are implying that the earth is designed to sustain our life. I'm saying, that assumption is moronic, and even a child should easily be able to come up with a counter argument. Even that aside, a watch isn't a biological or natural system, so you can't use it as a basis of comparison. Biological systems get their complexity from evolution and natural selection, something that has been proven true so many times it's hard to put it into words. I'll cover that in a moment..

if you're argument was a very valid argument and science has 100% proven that there is no God, and that everything was just a big fucking mistake then; then somebody would get up on stage and declare it on TV on newspapers... they declare that there.is.no.GOD.

I never said science said there was no god, I said there is no evidence for god. You can never prove something doesn't exist unless it's existence hinges on something that does. What I said was that if something lacks evidence, there is no reason to put faith in the idea. Because the idea of your god is no different then a talking ham sandwich, prove me wrong!?

they'd enlighten 95% of the world; but they wouldnt do that because they cannot make it as a fact..creationism makes more sense, bro sorry.

Then please, explain to me the following:

ERV's:

How is it possible that we share 7 ERV's with chimps and no other species on other branches of the nested hierarchy?[1]

Endogenous retroviruses provide yet another example of molecular sequence evidence for universal common descent. Endogenous retroviruses are molecular remnants of a past parasitic viral infection. Occasionally, copies of a retrovirus genome are found in its host's genome, and these retroviral gene copies are called endogenous retroviral sequences. Retroviruses (like the AIDS virus or HTLV1, which causes a form of leukemia) make a DNA copy of their own viral genome and insert it into their host's genome. If this happens to a germ line cell (i.e. the sperm or egg cells) the retroviral DNA will be inherited by descendants of the host. Again, this process is rare and fairly random, so finding retrogenes in identical chromosomal positions of two different species indicates common ancestry.

http://www.talkorigins.org/faqs/comd...retrovirus.gif

In humans, endogenous retroviruses occupy about 1% of the genome, in total constituting ~30,000 different retroviruses embedded in each person's genomic DNA (Sverdlov 2000). There are at least seven different known instances of common retrogene insertions between chimps and humans, and this number is sure to grow as both these organism's genomes are sequenced (Bonner et al. 1982; Dangel et al. 1995; Svensson et al. 1995; Kjellman et al. 1999; Lebedev et al. 2000; Sverdlov 2000). Figure 4.4.1 shows a phylogenetic tree of several primates, including humans, from a recent study which identified numerous shared endogenous retroviruses in the genomes of these primates (Lebedev et al. 2000). The arrows designate the relative insertion times of the viral DNA into the host genome. All branches after the insertion point (to the right) carry that retroviral DNA - a reflection of the fact that once a retrovirus has inserted into the germ-line DNA of a given organism, it will be inherited by all descendents of that organism.

With an average of 150,000,000 (average of the possible insertion points (ERV dependent)) with 7 known overlaps which match the phylogenetic tree perfectly. Here's a question for the math majors and actuaries out there. With 150 million possible landing points, what are the odds of throwing a dart twice, and having it land on the same point, then repeating that 6 more times? What ever that number ends up being it the odds that it happened by chance. However, if we look at it through common decent, it's not only expected, it's likely. We aren't the only species that share ERV in our genetic code that lines up perfectly with a nested hierarchy. We've identified over 70 ERV's in over 24 species that perfectly match the phylogenetic tree. Creationism can't explain this, unless you make the claim that god wanted it to look like we all evolved.

http://www.youtube.com/watch?v=De-OkzTUDVA
http://www.youtube.com/watch?v=-uNCDm-4tiQ

Transposons:

Transposons is one of the primary methods used for determining genetic decent. Courts use this method to determine guilt in cases where genetic information is available. It's not only used daily, but in every major country. How is it possible that within the most numerous SINEs element in the human genome, the human alpha-globin gene cluster, there are 7 ALU elements and each one is shared with chimpanzees in the exact same 7 locations?[2]

In many ways, transposons are very similar to viruses. However, they lack genes for viral coat proteins, cannot cross cellular boundaries, and thus they replicate only in the genome of their host. They can be thought of as intragenomic parasites. Except in the rarest of circumstances, the only mode of transmission from one metazoan organism to another is directly by DNA duplication and inheritance (e.g. your transposons are given to your children)

The DNA sequences in intergenic regions (regions between protein-coding genes in genomes), include very many transposons (like LINEs and SINEs), endogenous retroviruses (like HERVs), pseudogenes, and other related sequences like microsatellites. Many microsatellites are closely associated with and generated by retrotransposons like LINEs and SINEs (Arcot et al. 1995; Nadir et al. 1996; Wilder and Hollocher 2001; Yandava et al. 1997). These intergenic sequences are primarily responsible for the very specific patterns seen in "DNA fingerprinting" analyses, like those performed in paternity testing or sibling testing. Like fingerprints, these intergenic regions vary considerably between individual organisms and the patterns are largely arbitrary. For instance, Alu elements, one type of SINE retrotransposon, transpose into a new genomic location about every 200 human births (Deininger and Batzer 1999), and Alus contribute to a significant fraction of human genetic diversity (Batzer and Deininger 2002). In the case of the human L1 transposon, only one of many human LINE elements, a novel retrotransposition is harbored by around 1 in 20 individuals (Scaringe et al. 2001; Ostertag and Kazazian 2001). This is a conservative estimate, given that each of us has around 50 retrotranspositional competent L1 LINEs (Brouha et al. 2003). Intergenic regions of the genome, like all DNA, is heritable and there is a very strong correlation between relatives. When two individuals are found that share specific intergenic patterns far above that expected by chance alone, it is very strong evidence of common ancestry. This is in fact the very scientific basis behind DNA fingerprinting.

Most importantly, in the human α-globin cluster there are seven Alu elements, and each one is shared with chimpanzees in the exact same seven locations

It's true for other species as well:

More specifically, three different specific SINE transpositions have been found in the same chromosomal locations of cetaceans (whales), hippos, and ruminants, all of which are closely related according to the standard phylogenetic tree. However, all other mammals, including camels and pigs, lack these three specific transpositions (Shimamura 1997).

Pseudogenes:

How is it possible that humans, chimps, gorilla, organgutan, and gibbon all posses the Psi Eta-globin locus (a hemoglobin pseudogene), showing a distancing of similarities matching exactly with the phylogenetic tree?[3]

Other molecular examples that provide evidence of common ancestry are curious DNA sequences known as pseudogenes. Pseudogenes are very closely related to functional, protein-coding genes. The similarity involves both the primary DNA sequence and often the specific chromosomal location of the genes. The functional counterparts of pseudogenes are normal genes that are transcribed into mRNA, which is in turn actively translated into functional protein. In contrast, pseudogenes have faulty regulatory sequences that prevent the gene from being transcribed into mRNA, or they have internal stop codons that keep the functional protein from being made. In this sense, pseudogenes are molecular examples of vestigial structures.

There are very many examples of redundant pseudogenes shared between primates and humans. One is the ψη-globin gene, a hemoglobin pseudogene. It is shared among the primates only, in the exact chromosomal location, with the same mutations that destroy its function as a protein-coding gene (Goodman et al. 1989). Another example is the steroid 21-hydroxylase gene. Humans have two copies of the steroid 21-hydroxylase gene, a functional one and a untranslated pseudogene. Inactivation of the functional gene leads to congenital adrenal hyperplasia (CAH, a rare and serious genetic disease), giving positive evidence that the 21-hydroxylase pseudogene lacks its proper function. Both chimpanzees and humans share the same eight base-pair deletion in this pseudogene that renders it incapable of its normal function (Kawaguchi et al. 1992).

Pseudogenes & Endogenous Retroviruses (ERV):
http://www.youtube.com/watch?v=RCHcH9XLNfI

DNA coding redundancy

If humans and chimps aren't genetically related, how come cytochrome c in humans and chimps differ by only four nucleotides (a 1.2% difference), even though there are 10^49 different sequences that could code for this protein?[4]

Comprehensive DNA sequence comparisons of conserved proteins such as cytochrome c also indirectly take into account amino acid sequences, since the DNA sequence specifies the protein sequence. However, with DNA sequences there is an extra level of redundancy. The genetic code itself is informationally redundant; on average there are three different codons (a codon is a triplet of DNA bases) that can specify the exact same amino acid (Voet and Voet 1995, p. 966). Thus, for cytochrome c there are approximately 3104, or over 1046, different DNA sequences (and, hence, 1046 different possible genes) that can specify the exact same protein sequence.

Here we can be quite specific in our prediction. Any sequence differences between two functional cytochrome c genes are necessarily functionally neutral or nearly so. The background mutation rate in humans (and most other mammals) has been measured at ~1-5 x 10-8 base substitutions per site per generation (Mohrenweiser 1994, pp. 128-129), and an average primate generation is about 20 years. From the fossil record, we know that humans and chimpanzees diverged from a common ancestor less than 10 million years ago (a conservative estimate - most likely less than 6 million years ago) (Stewart and Disotell 1998). Thus, if chimps and humans are truly genealogically related, we predict that the difference between their respective cytochrome c gene DNA sequences should be less than 3% - probably even much less, due to the essential function of the cytochrome c gene.

CLUSTAL W (1.83) multiple sequence alignment


human_cytc ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCA GTGCCACACC
chimp_cytc ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCA GTGCCATACC
************************************************** ****** ***

human_cytc GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTT TGGGCGGAAG
chimp_cytc GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTT CGGGCGGAAG
************************************************** *********

human_cytc ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGG CATCATCTGG
chimp_cytc ACAGGTCAGGCCCCTGGATATTCTTACACAGCCGCCAATAAGAACAAAGG CATCATCTGG
******************** ***************************************

human_cytc GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCC TGGAACAAAA
chimp_cytc GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCC TGGAACAAAA
************************************************** **********

human_cytc ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGC TTATCTCAAA
chimp_cytc ATGATATTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGC TTATCTCAAA
***** ************************************************** ****

human_cytc AAAGCTACTAATGAGTAA
chimp_cytc AAAGCTACTAATGAGTAA

Pan troglodytes somatic cytochrome c (CYCS) gene, complete cds; nuclear gene for mitochondrial product
Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:22759 IMAGE:4280695), complete cds

Anatomical vestiges:

If we didn't evolve, why do we have anatomical vestiges which perfectly match the phylogenetic tree i.e. vermiform appendix (among others)?[5]

Some of the most renowned evidence for evolution are the various nonfunctional or rudimentary vestigial characters, both anatomical and molecular, that are found throughout biology. A vestige is defined, independently of evolutionary theory, as a reduced and rudimentary structure compared to the same complex structure in other organisms. Vestigial characters, if functional, perform relatively simple, minor, or inessential functions using structures that were clearly designed for other complex purposes. Though many vestigial organs have no function, complete non-functionality is not a requirement for vestigiality (Crapo 1985; Culver et al. 1995; Darwin 1872, pp. 601-609; Dodson 1960, p. 44; Griffiths 1992; Hall 2003; McCabe 1912, p. 264; Merrell 1962, p. 101; Moody 1962, p. 40; Muller 2002; Naylor 1982; Strickberger 2000; Weismann 1886, pp. 9-10; Wiedersheim 1893, p. 2, p. 200, p. 205).

For example, wings are very complex anatomical structures specifically adapted for powered flight, yet ostriches have flightless wings. The vestigial wings of ostriches may be used for relatively simple functions, such as balance during running and courtship displays—a situation akin to hammering tacks with a computer keyboard. The specific complexity of the ostrich wing indicates a function which it does not perform, and it performs functions incommensurate with its complexity. Ostrich wings are not vestigial because they are useless structures per se, nor are they vestigial simply because they have different functions compared to wings in other birds. Rather, what defines ostrich wings as vestigial is that they are rudimentary wings which are useless as wings.

Looking only at anatomical vestiges from humans:

The ancestors of humans are known to have been herbivorous, and molar teeth are required for chewing and grinding plant material. Over 90% of all adult humans develop third molars (otherwise known as wisdom teeth). Usually these teeth never erupt from the gums, and in one third of all individuals they are malformed and impacted (Hattab et al. 1995; Schersten et al. 1989). These useless teeth can cause significant pain, increased risk for injury, and may result in illness and even death (Litonjua 1996; Obiechina et al. 2001; Rakprasitkul 2001; Tevepaugh and Dodson 1995).

Another vestige of our herbivorous ancestry is the vermiform appendix. While this intestinal structure may retain a function of some sort, perhaps in the development of the immune system, it is a rudimentary version of the much larger caecum that is essential for digestion of plants in other mammals. For a detailed discussion of the vestigiality of the human vermiform appendix, see The vestigiality of the human vermiform appendix: A modern reappraisal.

Yet another human vestigial structure is the coccyx, the four fused caudal vertebrae found at the base of the spine, exactly where most mammals and many other primates have external tails protruding from the back. Humans and other apes are some of the only vertebrates that lack an external tail as an adult. The coccyx is a developmental remnant of the embryonic tail that forms in humans and then is degraded and eaten by our immune system (for more detail see the sections on the embryonic human tail and the atavistic human tail). Our internal tail is unnecessary for sitting, walking, and elimination (all of which are functions attributed to the coccyx by many anti-evolutionists). The caudal vertebrae of the coccyx can cause extreme and unnecessary chronic pain in some unfortunate people, a condition called coccydynia. The entire coccyx can be surgically removed without any ill effects (besides surgical complications), with the only complaint, in a small fraction of patients, being that the removal of the coccyx sadly did not remove their pain (Grossovan and Dam 1995; Perkins et al. 2003; Postacchini Massobrio 1983; Ramsey et al. 2003; Shaposhnikov 1997; Wray 1991). Our small, rudimentary, fused caudal vertebrae might have some minor and inessential functions, but these vertebrae are useless for balance and grasping, their usual functions in other mammals

Atavisms:

Why do humans carry the genetic information to create tails (Wnt-3a and Cdx1 genes) if we never had them?

Anatomical atavisms are closely related conceptually to vestigial structures. An atavism is the reappearance of a lost character specific to a remote evolutionary ancestor and not observed in the parents or recent ancestors of the organism displaying the atavistic character. Atavisms have several essential features: (1) presence in adult stages of life, (2) absence in parents or recent ancestors, and (3) extreme rarity in a population (Hall 1984). For developmental reasons, the occasional occurrence of atavisms is expected under common descent if structures or functions are gradually lost between ancestor and descendant lineages (Hall 1984; Hall 1995). Here we are primarily concerned with potential atavistic structures that are characteristic of taxa to which the organism displaying the structure does not belong. As a hypothetical example, if mutant horses occasionally displayed gills, this would be considered a potential atavism, since gills are diagnostic of taxa (e.g. fish) to which horses do not belong. As with vestigial structures, no organism can have an atavistic structure that was not previously found in one of its ancestors. Thus, for each species, the standard phylogenetic tree makes a huge number of predictions about atavisms that are allowed and those that are impossible for any given species.

Newborn babies born with tails:

Primarily due to intense medical interest, humans are one of the best characterized species and many developmental anomalies are known. There are several human atavisms that reflect our common genetic heritage with other mammals. One of the most striking is the existence of the rare "true human tail" (also variously known as "coccygeal process", "coccygeal projection", "caudal appendage", and "vestigial tail"). More than 100 cases of human tails have been reported in the medical literature. Less than one third of the well-documented cases are what are medically known as "pseudo-tails" (Dao and Netsky 1984; Dubrow et al. 1988). Pseudo-tails are not true tails; they are simply lesions of various types coincidentally found in the caudal region of newborns, often associated with the spinal column, coccyx, and various malformations.

In contrast, the true atavistic tail of humans results from incomplete regression of the most distal end of the normal embryonic tail found in the developing human fetus (see Figure 2.4.1 and the discussion below on the development of the normal human embryonic tail; Belzberg et al. 1991; Dao and Netsky 1984; Grange et al. 2001; Keith 1921). Though formally a malformation, the true human tail is usually benign in nature (Dubrow et al. 1988; Spiegelmann et al. 1985). The true human tail is characterized by a complex arrangement of adipose and connective tissue, central bundles of longitudinally arranged striated muscle in the core, blood vessels, nerve fibres, nerve ganglion cells, and specialized pressure sensing nerve organs (Vater-Pacini corpuscles). It is covered by normal skin, replete with hair follicles, sweat glands, and sebaceous glands (Dao and Netsky 1984; Dubrow et al. 1988; Spiegelmann et al. 1985). True human tails range in length from about one inch to over 5 inches long (on a newborn baby), and they can move via voluntary striped muscle contractions in response to various emotional states (Baruchin et al. 1983; Dao and Netsky 1984; Harrison 1901; Keith 1921; Lundberg et al. 1962).

Although human tails usually lack skeletal structures (some medical articles have claimed that true tails never have vertebrae), several human tails have also been found with cartilage and up to five, well-developed, articulating vertebrae (see Figure 2.2.3; Bar-Maor et al. 1980; Dao and Netsky 1984; Fara 1977; Sugumata et al. 1988). However, caudal vertebrae are not a necessary component of mammalian tails. Contrary to what is frequently reported in the medical literature, there is at least one known example of a primate tail that lacks vertebrae, as found in the rudimentary two-inch-long tail of Macaca sylvanus (the "Barbary ape") (Hill 1974, p. 616; Hooten 1947, p. 23).

True human tails are rarely inherited, though several familial cases are known (Dao and Netsky 1984; Ikpeze and Onuigbo 1999; Touraine 1955). In one case the tail has been inherited through at least three generations of females (Standfast 1992).

As with other atavistic structures, human tails are most likely the result of either a somatic mutation, a germline mutation, or an environmental influence that reactivates an underlying developmental pathway which has been retained, if only partially, in the human genome (Dao and Netsky 1984; Hall 1984; Hall 1995). In fact, the genes that control the development of tails in mice and other vertebrates have been identified (the Wnt-3a and Cdx1 genes; Greco et al. 1996; Prinos et al. 2001; Schubert et al. 2001; Shum et al. 1999; Takada et al. 1994). As predicted by common descent from the atavistic evidence, these tail genes have also been discovered in the human genome (Katoh 2002; Roelink et al. 1993). As discussed below in detail, the development of the normal human tail in the early embryo has been investigated extensively, and apoptosis (programmed cell death) plays a significant role in removing the tail of a human embryo after it has formed. It is now known that down-regulation of the Wnt-3a gene induces apoptosis of tail cells during mouse development (Greco et al. 1996; Shum et al. 1999; Takada et al. 1994), and similar effects are observed in humans (Chan et al. 2002). Additionally, researchers have identified a mutant mouse that does not develop a tail, and this phenotype is due to a regulatory mutation that decreases the Wnt-3a gene dosage (Greco et al. 1996; Gruneberg and Wickramaratne 1974; Heston 1951). Thus, current evidence indicates that the genetic cause of tail loss in the evolution of apes was likely a simple regulatory mutation(s) that slightly decreased Wnt-3a gene dosage. Conversely, a mutation or environmental factor that increased dosage of the Wnt-3a gene would reduce apoptosis of the human tail during development and would result in its retention, as an atavism, in a newborn.

http://www.talkorigins.org/faqs/comdesc/images/tail.jpg

Figure 2.2.3. X-ray image of an atavistic tail found in a six-year old girl. A radiogram of the sacral region of a six-year old girl with an atavistic tail. The tail was perfectly midline and protruded form the lower back as a soft appendage. The five normal sacral vertebrae are indicated in light blue and numbered; the three coccygeal tail vertebrae are indicated in light yellow. The entire coccyx (usually three or four tiny fused vertebrae) is normally the same size as the fifth sacral vertebrae. In this same study, the surgeons reported two other cases of an atavistic human tail, one with three tail vertebrae, one with five. All were benign, and only one was surgically "corrected" for cosmetic reasons (image reproduced from Bar-Maor et al. 1980, Figure 3.)

Summation and the phylogenetic tree:

Why does every phylogenetic tree made by embryology, comparative anatomy, genetics, molecular biology, taxonomy and paleontology among many others match up perfectly?

http://stomped.com/mini/Phylo_Real_Animated.gif

http://www.youtube.com/watch?v=5MXTBGcyNuc
http://www.youtube.com/watch?v=-CvX_mD5weM

“Primates” are collectively defined as any gill-less, organic RNA/DNA protein-based, metabolic, metazoic, nucleic, diploid, bilaterally-symmetrical, endothermic, digestive, tryploblast, opisthokont, deuterostome coelemate with a spinal chord and 12 cranial nerves connecting to a limbic system in an enlarged cerebrial cortex with a reduced olfactory region inside a jawed-skull with specialized teeth including canines and premolars, forward-oriented fully-enclosed optical orbits, and a single temporal fenestra, -attached to a vertebrate hind-leg dominant tetrapoidal skeleton with a sacral pelvis, clavical, and wrist & ankle bones; and having lungs, tear ducts, body-wide hair follicles, lactal mammaries, opposable thumbs, and keratinized dermis with chitinous nails on all five digits on all four extremities, in addition to an embryonic development in amniotic fluid, leading to a placental birth and highly social lifestyle.

And how do creationists explain why it is that every living thing fits into all of these daughter sets within parent groups, each being derived according to apparently inherited traits? They don’t even try to explain any of that, or anything else. They won’t because they can’t, because evolution is the only explanation that accounts for any of this, and it explains it all.

This isn't even a fraction of the total proof that evolution is true. I have to stop here because this forum limits it's posts to 30000 characters, and I had to cut the post down a lot to fit everything. I didn't even touch on things like, paleontology (and the tons of Intermediate and transitional forms we have of just hominids[6]), the universal genetic code, common metabolism, comparative anatomy, ontogeny, morphological comparisons, biogeography, anatomical/molecular suboptimality & parahomology & analogy. It's been said that biology makes no sense with out the light of evolution.

[6]http://stomped.com/mini/hominids2.jpg

Evolution is a fact, if you took a few moments out of your day to read something that wasn't already proven to be full of falsehoods and contradictions, you might realize that.

******************

[1]Bonner, T. I., C. O'Connell, et al. (1982) "Cloned endogenous retroviral sequences from human DNA." PNAS 79: 4709

Dangel, A. W., B. J. Baker, et al. (1995) "Complement component C4 gene intron 9 as a phylogenetic marker for primates: long terminal repeats of the endogenous retrovirus ERV-K(C4) are a molecular clock of evolution." Immunogenetics 42: 41-52.

Svensson, A. C., N. Setterblad, et al. (1995) "Primate DRB genes from the DR3 and DR8 haplotypes contain ERV9 LTR elements at identical positions." Immunogenetics 41: 74.

Kjellman, C., H. O. Sjogren, et al. (1999) "HERV-F, a new group of human endogenous retrovirus sequences." Journal of General Virology 80: 2383.

Lebedev, Y. B., Belonovitch, O. S., Zybrova, N. V, Khil, P. P., Kurdyukov, S. G., Vinogradova, T. V., Hunsmann, G., and Sverdlov, E. D. (2000) "Differences in HERV-K LTR insertions in orthologous loci of humans and great apes." Gene 247: 265-277.

Sverdlov, E. D. (2000) "Retroviruses and primate evolution." BioEssays 22: 161-171.

[2] Sawada, I., C. Willard, et al. (1985) "Evolution of Alu family repeats since the divergence of human and chimpanzee." Journal of Molecular Evolution 22(316).

[3]Molecular evolution of the psi eta-globin gene locus: gibbon phylogeny and the hominoid slowdown -- Bailey et al. 8 (2): 155 -- Molecular Biology and Evolution

[4]Pan troglodytes somatic cytochrome c (CYCS) gene, complete cds; nuclear gene for mitochondrial product

Homo sapiens cytochrome c, somatic, mRNA (cDNA clone MGC:22759 IMAGE:4280695), complete cds

[5]Vestigiality of the human appendix

[zoobernut]

Kareface you are my hero for that last post. Not only is your patience amazing but the post is comprehensive and well typed out.

[Tristam]

I would contend the most important difference between science and religion is that at least scientific theories are based on independently observable and repeatable facts. The reason we summarize the facts incorporated into theories is because noone is going to sit here and quote big Alberts or Lehninger. Whereas religious theories are based on an assumption from tradition.

edit: actually I stand corrected, given enough time and arguments, I fully expect Kareface to quote Alberts in its entirety, and perhaps a medical text or two.

[Mizango]

Mini, I love you.

Inb4 Firas retorts with "Allah did it, 70 virgins at my call and Derka"

On a related note, when I took Biology 2 in HS, we did a study on children born with tails and it is much more common that one might think. I don't recall the particulars but I remember my teacher, Dr. Cornell, showing us slides and going on and on about it for 2 weeks.

I don't remember the particulars but it was something that stuck with me for a very long time and made me delve farther into evolution as a whole. Neil Shubin goes into great detail about this when he talks about an genetic experiment done on Sharks and Skates in the 1990s...where by inserting what has been dubbed the "Sonic Hedgehog" gene we can make cells form hands, fingers and the bones that can support the afore mentioned animals body weight if need be.

I don't have "Your inner fish" in front of me or I would post it verbatim.


Edit: Found a excerpt from Google books. Here is my Bible, my absolute.

Your inner fish: a journey into the ... - Google Book Search

[kareface]

That youtube video "10th Foundational Falsehood of Creationism" is awesome (the second to last of the 5 videos in the large post). I love the whole series, but that specific video is a great watch.

[Skjie]

I hope you put this much effort into getting a degree.

[Mizango]

God willing.

[kareface]

I hope you put this much effort into getting a degree.

Physics actually, and it something I've started worked at after getting laid off a few months back. I was originally in school for CS.

God willing.

The MWB will guide me.

[Plow]

Except Paley specifically meant the watch to be nature, humankind, and conceived with a purpose. He specifically *avoids* first cause (see the stone below). I think you're confusing the watch with the stone. Again, with first causes, the answer is that thus far what we know does not *require* a god. The only answer we can say with any certainty with respect to first causes is that we do not know, however that does not by itself invalidate natural causes, nor justify supernatural causes. Just because we do not know, does not mean you must ascribe the unknown to god, that is the god of the gaps. Rather, prove to me that something about first causes *necessitates* the existence of a god, and that that god itself requires no first cause.


Paley's original argument:

"In crossing a heath, suppose I pitched my foot against a stone, and were asked how the stone came to be there; I might possibly answer, that, for anything I knew to the contrary, it had lain there forever: nor would it perhaps be very easy to show the absurdity of this answer. But suppose I had found a watch upon the ground, and it should be inquired how the watch happened to be in that place; I should hardly think of the answer I had before given, that for anything I knew, the watch might have always been there. (...) There must have existed, at some time, and at some place or other, an artificer or artificers, who formed [the watch] for the purpose which we find it actually to answer; who comprehended its construction, and designed its use. (...) Every indication of contrivance, every manifestation of design, which existed in the watch, exists in the works of nature; with the difference, on the side of nature, of being greater or more, and that in a degree which exceeds all computation."

Ok, you're right, Paley was using it to try to explain earth within the universe.


I still think it's a valid point if you view it *as* the universe. If you found the watch, and had no idea what it was, you may figure out every scientific property making it function, and everything about what it's made out of, how it was made, etc., without ever even figuring out that it's a "watch" and its purpose is to tell time (especially if it's flawed and inaccurate).


At this point, we've found the watch (the universe). Unfortunately, so far we don't even have the advantage of seeing it from the outside, let alone understanding the concepts that govern that "outside."

The whole concept of "It just is" seems no sillier in the context of God than in the context of the universal laws, to me.


Too much of religion, on both the side of religious and anti-religious, is based around silly stories like "Rain is God crying. Oh, and God apparently likes to bowl when he cries, because that's what thunder is."






Also, giant evolution post is like drop kicking a 2 year old, while the crowd chants "champion!"

[Mizango]

Only a bad dude can drop kick a toddler.

[kareface]

I love this guy, his videos are always well thought out and he doesn't pull his punches.

http://www.youtube.com/watch?v=2TkY7HrJOhc

Creationists contend that they don’t believe in magic. But “speaking” anything into existence is an incantation, and the Bible is full of spells of one sort or another. Animating golems, or conjuring interdependent systems, and causing complex organisms to appear out of thin air -are each logically implausible and physically impossible according to everything we know about anything at all, yet this is exactly what religiously-motivated pseudoscientists actually promote!


How do we test these ideas? How can we tell them apart from any of the thousands of fables men have concocted for the ghosts and gods of other religions? How can we tell whether any of this is even real, and not something someone just made up? Because despite anyone’s assertions of personal conviction, it is impossible to distinguish miracles from subjective impressions imagined out of nothing. In the realm of fantasy, it’s easy to demonstrate psionic talents, astral entities, and magical manifestations. Until they do that in reality too, then science has nothing but nature to work with.

Fraudulent evangelical charlatans often say that creationism is scientific, but there’s utterly no verifiably accurate evidence behind any of their assertions, and no way to construct any hypotheses to explain any of their claims because no experiments could possibly support them, and faith prohibits believers from ever admitting when their notions would be falsified. Creationists are therefore unable to add to the sum of knowledge and instead only offer excuses trying to actually reduce what we already know. They’ve no way to recognize their own flaws and won’t correct them, so they can neither confirm nor improve their accuracy. But that’s all real science is or does.


Consequently, since the dawn of rational thought, the advancement of science has been retarded by the minions of mysticism, and profound revelations have often been opposed or suppressed by the greater part of the dominant religion, because dogmatic faith is not based on reason and zealots will not be reasoned with.

There's even a clip of one of the guys firas posted in this video, lol.

[Zilong]

sorry, i was provided with theories...no facts, if science cannot provide facts, then its never going to disprove creationism.

the entire fucking world changed and changed and changed, and it can change away from this, if someone can really prove that there is no God, but noone can prove that...

they.are.just.fucking.theories

If there is an all powerful, all knowing god, let me be strike down by lightning for declaring of his non-existence by the end of this post.

I know, it's hardly a proof, but this is what you've pretty much been doing this entire thread.

[Mizango]

I watched that video on Nova a long time ago lol. For further proof about how Science, unlike religion is a self regulating and self correcting system, look no further than the headlines in Sciencedaily from this morning.

Discovery Raises New Doubts About Dinosaur-bird Links

This goes on constantly and never ends no matter what new "theories" come out, don't like them? Prove them wrong. Fame and fortune await you! Don't worry about smiting us lowly little BG scientists, go for the glory. Now imagine for a second that a church leader or a politician would propose that everything in that little black book is false, he would be committing professional suicide.

I personally think its nice to be able to think freely with out having people that are supposed to judge me, judge me. If you were to doubt the validity of the story you were told your family and friends would probably disown alot of you? Peer pressure and family pressure keeps you on the straight and narrow. The thought of thinking outside the box and questioning ANYTHING was the devil's work and should be dealt with by going to church more.

That sound about right? We find flaws all the time in our work, only were man enough to admit it and say it publicly.

I mean if you had absolute, irrefutable that God was in the sky you would be the most famous man in history bar none. You could shut all of us up as well as every scientist on the planet. Not only that but think of how appreciative Allah would be that a mere mortal changed the world. I'm sure he would increase your virgin count hundredfold. Go ahead, show us. Its shit or get off the pot time Firas, seriously lol.

We are all waiting on just ONE fact or shred or proof. No more analogies, No more hypotheticals, No more "well my mama said...". Fuck that, you said yourself "the Qur'an if all facts". Show us just one. That's all were asking.

[Mizango]

If there is an all powerful, all knowing god, let me be strike down by lightning for declaring of his non-existence by the end of this post.

I know, it's hardly a proof, but this is what you've pretty much been doing this entire thread.

Exactly.